Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11110D7
Clone ID IST11110D7
Vector VICTR76
Project tigm

Sequence tag IST11110D7HMF1
Sequence
CTCTGACGAGCTCTGATGAGGACACGTGAGCATGAGGGCTCACCTGTTCCCAGAAATACCAATTCTTCTGTATAGCGGAG
CCCCCTGGGAACCACTTAATTCAGTCCCCAAAGCAGTTTCAAGGCTTGCCTCCCTTTGAGGGTCTACTGGTCAGGATGAT
CTGAAGTTAATGCCGCTTAATTGGTGTTCTCGGGGCTTAGTCATGGGAGCTCATGGGAGCGGCTTCCTCGAAAAGCTTCA
CTGGGTCTGTTGCTAGGGACAAAGCCTTTCAGAGGGTAACTGCTCTTCTTTCCGGGGCGTCTTTTGGCTTATGCTTTTGA
TTCTCTCCCCAGGANGCATCCCAGTCCTGANGTCAGGGAGCCCCCTCCCCGACATTGCTCACCCCTCTCGGANTANCCTG
GGAAGGTTCTCTAGCTTTTCTGCATCTATTTNATGTACTGATTTCCTGGCTCANCACAGCCN

Sequence Type genomic DNA
Unitrap ID UNI29191

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29351487..29351947 449
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024008 (Cpne5) NM_153166 copine V Gene [Source:MGI (curated);Acc:Cpne5-001]

 
Come back to gene ENSMUSG00000024008


For any suggestions or comments, please send an email to unitrap@crg.es