Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AB0022
Clone ID AB0022
Vector pGT0lxr
Project sanger

Sequence tag AB0022
Sequence
CGGGAAACTGAAGCCTACTTTGCTGACCTGATAATGAAAAATTACTTTGCACCACTGGATGTCGTTTACTGCATCGTCAG
TGAAGCAGGGGCCTCCATCTACAGTGTCAGCCCCGAAGCGAACAAGGAGATGCCAGGACTGGACCCTAACTTGAGAAGTG
CAGTTTCCATAGCAAGGCGTGTTCAAGATCCATTAGCTGAGCTAGTGAAATTTGACCCGAAGCACATTGGAGTTGGAATG
TATCAG
Sequence Type mRNA
Unitrap ID UNI3421

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 86450426..86457138 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024135 (Srbd1) S1 RNA binding domain 1 Gene [Source:MGI Symbol;Acc:MGI:1925836]

 
Come back to gene ENSMUSG00000024135


For any suggestions or comments, please send an email to unitrap@crg.es