Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13105F6
Clone ID IST13105F6
Vector VICTR76
Project tigm

Sequence tag IST13105F6HMF1
Sequence
CTTGTAGGCAGTCCATTAGGATGGGCTGAGAAGGCAAACGCCCCACTGCCCTTGGGTTGTTTCCATTGTCCTTTCTGTTT
TCCAAGCTTTTGCTCTGCTGTTTGGCTCTGTCACTCAGTAGTGCCACCTGGTGGA
Sequence Type genomic DNA
Unitrap ID UNI5014

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96067630..96067763 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041440 (Gk5) NP_796326 glycerol kinase 5 (putative) Gene [Source:MGI (curated);Acc:Gk5-001]

 
Come back to gene ENSMUSG00000041440


For any suggestions or comments, please send an email to unitrap@crg.es