Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13044D11
Clone ID IST13044D11
Vector VICTR76
Project tigm

Sequence tag IST13044D11HMR1
Sequence
GCATGTGTCTCCTTTTCTAAGACAGCTTTGTGCATATCTATTACTGCATTTTAAAATGTGAGTCAGTTGCCAAGGAAACA
GGTTCTGGCCCAGTGTTAATTTGAAACTAAAATATTTTTGAGGGGTTAGGCTGAAAGGAAAGGGCACATGAGATGGTTTT
GAAAGATGCCAGGATTGGGCACTTGGAGAGCCACAACTGTATTTCTGCAGTGAGCCGTTCTAGGGGTTCAGCTTCATTTA
NTGGAGCTCAATTTCAGCTAGGAGGGCCATGGACACTTANCCTTTTTCCCTTTAAAAACNATAACTCCCCGTCCCCCTGC
TCCATGCACAAACAAATGGTGGATTTATCATTGTATTTGACAAANTATC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96630884..96631251 360
 
EST/CDNA Est Name
  BB284375.1 - BB822040.1 - BB759744.1 - BF460878.1


Sequence tag IST13044D11HMF1
Sequence
ATGCCAAGTGAGAACCCTATAGTTGTGTGTCCTCTCCTACAGAATTCNAACTGGCTTTANACTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI20682

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96630818..96630887 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040433 (Zbtb38) NM_175537 zinc finger and BTB domain containing 38 Gene [Source:MGI Symbol;Acc:MGI:2442866]

 
Come back to gene ENSMUSG00000040433


For any suggestions or comments, please send an email to unitrap@crg.es