Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10059E7
Clone ID IST10059E7
Vector VICTR75
Project tigm

Sequence tag IST10059E7BBF2
Sequence
GCTGTAACATTTGCCAATAGGAATCAAGAGTTTGCAGGAGGCATCCTCCAGTCCCAGACCCCTGGATGACGGTACACAGT
CAATTCTTTCACCATCAGACAACCTGAAGTGGGCAACACAGTGTGCTCAGTGTTTGCTGAAAGACAGCTACTCTCTGGCC
AGCGTGATAAGACATTTATTAGTTCAGAGCTAGAAAGAGCAAGAGTCCAATAGCTTTTTCAGTAAAGGCTGTCTTGTGGC
TGAGCATCTAGCCTGCCCTCCTGACTCTACAGTTTGCCCTGCTATTAAGGCACTTGAAAAAAGGGGGAGCAGTGATGTCT
CAGACTAAACTCCCCCCGATTCTGAAGGCGGCCAGCAACATCCCACCTGTTCCCCTTGGCCACAGCTCAGCATGGAGAGC
TGGCAGGGCAGGAGCTCCACAGGACAGAAGAGCGGCCCCTCATGTGCTGGTGTCGGGCAGCACCACGTAGGAGCTGCTCT
TGGGAGCACTGCTTTGGGATCAACGTGTACAGGAATCCGCGTGGAGAAGACACTTGATAGTAAGGCTATTATGGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5647737..5648289 539
 
EST/CDNA Est Name
  BF467148.1 - CO041036.1 - EH109435.1 - AW545097.1 - DT912975.1 - BP769059.1 - BM227791.2 - BG061920.2 - AI131648.1 - AI119739.1 - AI118530.1 - AI848787.1 - AW212680.1 - AW045966.1 - AI843211.1 - BM232400.2 - BQ550534.1 - CK335332.1 - BX634020.1


Sequence tag IST10059E7HMF1
Sequence
AAACAAGTTATCAAGTCTCATTGATAAACAGTAGACCGGTGTGGTGTAAGATTCAAGGGTGAACCCTAGGGAAATTCTTT
GGAGGAATTTTAGAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86591499..86591595 97
NO GENE  


Sequence tag IST10059E7BBR1
Sequence
TTTTGTGTTGATTGCAAAGTGACCCTCACTCTTAAACCCCAGAGGATGTGAAGAGATGGCCAAGTTTCAATAAGATTGGC
TTTAATTTGGGGGATTTAGTTGTCAGAAGTTGAATCTCCTCCTGGAGAGATGTGATCTTTGGCCAGAGATGTAGAGGATC
CG
Sequence Type genomic DNA
Unitrap ID UNI30096

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86591593..86591752 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031706 (Rfx1) NM_009055 regulatory factor X, 1 (influences HLA class II expression) Gene [Source:MGI Symbol;Acc:MGI:105982]

 
Come back to gene ENSMUSG00000031706


For any suggestions or comments, please send an email to unitrap@crg.es