Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10110F7
Clone ID IST10110F7
Vector VICTR76
Project tigm

Sequence tag IST10110F7BBF2
Sequence
GCTTAAGAGTTACCTGTGTCTATTAACTTCCTACAAGGAGTACCAAGTTAATAATGGAGAAACATATGTAACCAATATCA
TGATAACCAGGTAATCAAGATTAAGGGAATAATGACATTGAAAGTAAACACTTTTAGTAGGATGTGATGAAGGTGGCCCT
TTATATCTGTGTCCTTTCTCCCTAGAATGCATTGTTTTGGTTTAGTCTCAAGGAACATATCAGGCCAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 124619902..124620133 232
NO GENE  


Sequence tag IST10110F7HMF1
Sequence
GCTTAAGAGTTACCTGTGTCTATTAACTTCCTACAAGGAGTACCAAGTTAATAATGGAGAAACATATGTAACCAATATCA
TGATAACCAGGTAATCAAGATTAAGGGAATAATGACATTGAAAGTAAACACTTTTAGTAGGATGTGATGAAGGTGGCCCT
TTATATCTGTGTCCTTTCTCCCTAGAATGCATTGTTTTGGTTTAGTCTCAAGGAACATATCAGGCCANATCTTATANAAT
TGCATTCCACANAATACTTCNAAGCTGTTAAGGTTCTTATGAAAACCNNNGAAAATGTGTGATTACAGCANANNNAANCT
GTTGGTTCGGGTTCTTCTTGCCTCAGGACACAGTTGCTTGGGAGTTTGACTGTACTTATCGCANAGTGGANCANTCCAGT
TGAAGATGGGAGACAGCANACATTGNTATTCCCTTGCTTCTNNNCTATCAGTTGCNGCTGGNNAACTGNTTGGAAAAGAC
NAGACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10110F7BBR1
Sequence
CCTGAACTGCAACTTAAAATCCTTTCCGAAGATCGTTTGGAATTTCAAAATAATGGGACCTGTGAAAAATCTCCATCTTA
ATGCTAAGCCTTAAACGGCTCTTCCAGGAGAACACTATCGGATTTTTATATTTTAAAATTTAAATCTCTTGACTCCAAAG
CCATAAAACATTTTTGTATGTGTGGGTGTACCGTTTGCCAGAGCACTCATGTTAAAGACTGACTTCTTTTTTTTAAATAA
TGGTGTGATATTTTCTGGGTTGCAGGGAGGGGGAGGGGGCTGTGGCATCACCTAGCCCCTTCCCGTGTAAACGTCTGTAT
GGACCATGCTGGTTCATTTGTTGCACTCTATGCGGATGGGTGTTCTGTGGTAGTCTGTTCTCACTCTCCATGTGTTCCTC
AGCTCTTGGTTAAGTAGTGGAATGATGGTGAGTGATGTATTTCCCCCTTAAAAACTGACCAGATGATGGAGACAAACCTT
CAGGTGGAAGGTAGCAAGTGGTGAGGGGAGGAAGAGGTTCTGTACACAACAGGTACCAACATTAGTGCTGGATAATGCTC
TTGGGATCTAAGATCC
Sequence Type genomic DNA
Unitrap ID UNI17948

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55061950..55062525 517
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060206 (Zfp462) NM_172867 zinc finger protein 462 Gene [Source:MGI (curated);Acc:Zfp462-001]

 
Come back to gene ENSMUSG00000060206


For any suggestions or comments, please send an email to unitrap@crg.es