Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14750H8
Clone ID IST14750H8
Vector VICTR76
Project tigm

Sequence tag IST14750H8BBF1
Sequence
TCTATTGTCTACTCTCTCAAAAGGGAAAATTTTTATAAACCAGCTTCATCTGAGCCACATTTGGGGGCGAGTGGCTTGTT
AAAGGATACAAATGAGTTGTACTGTCCCTAATACAATGGCTCTTGGCAAAGCTTGTATTTCAAAGCTGTGGTTAACCAGA
AACTAGGCTGCCGCTCCTGCTAATCTGAGGAGTTTTTTTTCTTCTGTTGCCCCAGTCTAATTTTCTCAGCTAGTAAACAC
AGCGGTGCCAAGGAGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 110363548..110363807 260
NO GENE  


Sequence tag IST14750H8HMF1
Sequence
TCTATTGTCTACTCTCTCAAAAGGGAAAATTTTTATAAACCAGCTTCATCTGAGCCACATTTGGGGGCGAGTGGCTTGTT
AAAGGATACAAATGAGTTGTACTGTCCCTAATACAATGGCTCTTGGCAAAGCTTGTATTTCAAAGCTGTGGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 110363652..110363807 156
NO GENE  


Sequence tag IST14750H8HMR1
Sequence
TTGACAAGTTTCTAGGGTAACAAGGGGGGCTTTGATGTGTGTTGAAGCTGGAAGCATTTCCATTTAAAATCTGGATTTAT
TCACAGAGACACCCAAACTCTTCGTATCAGATCAGGTGACTTACACAACTAAATGGGGCCGTGTACACTTAAATGCAAAG
GTGCCAAATACAGAGCCAGCTGTATAANAACGGCTTGGTCTATGGAACTGGAGAGATGGCTCATTGCTAATCTTGCANAG
GGCTGGGGTTTAGTTTCCAGGACCCACATGATGGCTCAAAACCAGCTGAAATACCAGTTCCACAAGTCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI10771

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 110363806..110364115 306
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020186 (Csrp2) NM_007792 cysteine and glycine-rich protein 2 Gene [Source:MGI Symbol;Acc:MGI:1202907]

 
Come back to gene ENSMUSG00000020186


For any suggestions or comments, please send an email to unitrap@crg.es