Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14975B12
Clone ID IST14975B12
Vector VICTR76
Project tigm

Sequence tag IST14975B12BBF1
Sequence
CTGTCAGGCTCCCTGGACCCTCCCCTCCCCCATCAGCCCTTAGGCTTCCTCCCATTCAGGAAATAAACTTCGGCCTGGTA
TCTCTCACTCTCCACCCTTCCTGATCTGACTTTCTGTTCCAGTAGGATTATGGGATTGTCAGAGGAATGCCAGACACCCA
AGTAAGTTTGAATTCCAGATAAACAATGAATATTATTTTTAGGGTAAGTATCCCAAAATGTTTTCTGAGACAGTGAAGGC
ATTATTATGCAAAATAGAATTACTTTTTATTTTTGAGTCTTGTTCCTTTGTTTTGAGACAGTCTGCTACATAGTCAGGCC
TCAGCTTGAATGGTCTCTGTAGCATAGGATGACCTTGAACTCCTTGACTTTTCTGCCTCTGTTTGCTTGGATNACAGATG
TGGGTCACCTCCCAAACTCTCCATCAATGGCTTTTTACCAAAGCTTGATGCCTTGCTAANGCCTCACTAGTTGGTTTCCT
NATGTANTGGANGCNNGTGCATATNNTANACAGGGTCNATCTNNGTGTNNCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 74356066..74356593 502
 
EST/CDNA Est Name
  BY509223.1


Sequence tag IST14975B12HMF1
Sequence
CTGTCAGGCTCCCTGGACCCTCCCCTCCCCCATCAGCCCTTAGGCTTCCTCCCATTCAGGAAATAAACTTCGGCCTGGTA
TCTCTCACTCTCCACCCTTCCTGATCTGACTTTCTGTTCCAGTAGGATTATGGGATTGTCAGAGGAATGCCAGACACCCA
AGTAAGTTTGAATTCCAGATAAACAATGAATATTATTTTTAGGGTAAGTATCCCAAAATGTTTTCTGAGACAGTGAAGGC
ATTATTATGCNANNNNNAATTACTTTTTATTTTTGAGTCNTGNTCCTTTGTTTTGANACAGTCTGCTACATAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 74356282..74356593 294
 
EST/CDNA Est Name
  BY509223.1


Sequence tag IST14975B12HMR1
Sequence
GGAGGCTGGGTCTACACGGTTGTGCTGTGCGCTGCCCACTCCAGAATCCCTTCCATAGCTCTGTGACTGCCTAGGCAGCT
TTCCTGGAGTTTCCCAGCCCTGTGAGGCTTTGCTGTGTATCANCTACCTCACTGAAGGTGCCCTCCTCANAGGGCTTTCC
CACTGGAGACGAGCCTCTTCCCTCTTTTCCATCACCTGTAGGAGCGGAAGTGCCCTGCAGCTCTTTGCTGGGACAGGAAG
ACAATTGTGAACTATACNAGAGGAGAGGGAAGGTGGGAGTTGGGGGAGGACACAGGTCCTTCCTCCTATAAAGGAGCCTT
GTGGTGTTTTGTTNNGTTTTGTTTTGTTTTTA
Sequence Type genomic DNA
Unitrap ID UNI33424

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 74356610..74356960 341
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026179 (Pnkd) NM_019999 paroxysmal nonkinesiogenic dyskinesia Gene [Source:MGI (curated);Acc:Pnkd-001]

 
Come back to gene ENSMUSG00000026179


For any suggestions or comments, please send an email to unitrap@crg.es