Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14499H2
Clone ID IST14499H2
Vector VICTR74
Project tigm

Sequence tag IST14499H2HMR1
Sequence
GANCTACTACTCAAGANAAAACATTCTTAACTTTGTCTCTCAGTTACCTACATTTCAAGCAGCTGTGTGATGTGCCCACA
AGGCCACAGTTAAAATACATACATGGAACTCTGCTCAGGGAGACCTAAAACAAAACAACCTTCACCGCCGAGGCTTGAAC
AGGAATGGCTTCCATAAACTCATGTGTCTGAATGCTTGAATGGCACTATTAGGAGGTGTGGCCTTGTTGAAGGAAGTGTG
TCACTGTTGGGGTGGGCTTTGANGTCTCCTATGCTCAGGCTATGCCCAGTGTGGAATCTANTCTCTTCTTGGTTGCCTGC
CAAATAAAGTCTCCTACTGCCTTCGGCTCAAGATGGANAACCCTTGGCCCNTCTTACNNNCNGNNNGTGGNNNNGNGNNN
NGCNATANTGATAATGGACTNANNCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 61393087..61393459 359
NO GENE  


Sequence tag IST14499H2BBF1
Sequence
CCCTGCATCCATCCTTCCCTCCGTTCCCGTTCACATACTCAACAAGTACCGGCCAAACACACTCAATCAGCGCCAGCCAC
TCTGGTCCATGCAATTAAAACTAGTGGATGTGAGAGGGCCACAGAGAACATGTGTGAGGAATTAGCACCCCACAGACCAG
ATGGGTCTCAAGGCTCTGTTGGGCTTGCAGAAAGGCTTTTCANATTTTGCTGACTCAGCACCAACATCTTGAAACCAGAA
CTTTGTATTTAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI19923

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 61392809..61393065 255
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058806 (Col13a1) NM_007731 collagen, type XIII, alpha 1 Gene [Source:MGI (curated);Acc:Col13a1-005]

 
Come back to gene ENSMUSG00000058806


For any suggestions or comments, please send an email to unitrap@crg.es