Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST436080
Clone ID OST436080
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST436080
Sequence
CCGTTAATGGGAATTGAAGTTCCACCTCCAAGAGGAGGCCCTGCTGATTTCTCTGAGCAGCCTGAGTCTGGTTCTTTGTC
TGCACTCACACCAGGAGAGGAAGCTGGGCCTGAAGTAGGAGAGGATAATGACAGAAATGATGAAGTGTCCATCTGTTTGT
CCGAAGCAAGCTCTCAAGAGGAGTCCAATGAACTTATCCCAAATGAGACCAGGGCACATAAGGATGAAGAGCACCAGGCA
GTATCTGCAGATAATGTGAAAATAGAAATTATCGATGATGAAGAAAGTGACATGATAAGCAATTCTGAGGTAGAACAAGA
AAATTCTCTCCTGGATTACAAGAATGAAGAAGTCAGATTTATTGAAAATGAGCTAGAGATTCAAAAGCAAAAATACTTTA
AGCTCCAGTCTTTTGTTAGAAACCTGATTCTCGCTATGAAAGCTGATGATAAAGACGAG
Sequence Type mRNA
Unitrap ID UNI17811

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 108696410..108714401 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034551 (Hdx) NM_001080549 highly divergent homeobox Gene [Source:MGI (curated);Acc:Hdx-002]

 
Come back to gene ENSMUSG00000034551


For any suggestions or comments, please send an email to unitrap@crg.es