Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14713D11
Clone ID IST14713D11
Vector VICTR76
Project tigm

Sequence tag IST14713D11BBF1
Sequence
CTGAGAGGCCTGGGAGCATTCACGAGGCANANAGTTTCACGGAATCTCACCGTCTGGAACTTTGGTGTTCTCATAACCCA
TATACTCACATCCTATCCCCGCGTTANTCTGATGGATGGATACACATGCTCTCTTTTANTATTATTCTATTATAAGTGCC
TTTTTTTTTTTAAAAAAAATTTATTTATTTNNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52833552..52833741 180
NO GENE  


Sequence tag IST14713D11HMF2
Sequence
GCTTCTGGCTTACCTTCCATTTTCTTCCCCCAGCAGGCATGTGACACACAGCGGCCGACAGTGCAGGGGGAGGACTGTTC
AGAGAGAGAGGGAGAGGGGGGAGAGGAAGGGAGGGAAAAATAAAATAAAAGAAGGGGGGATAATAGCTTCTCTTTTGGCA
TACCAGGATCTAGCTTCAAACTAGTCCAGAAATTCTTTGTCCTGGTCAAAATAAAGGTATTCCNAGCCCTCACCAGTCTG
TAAAATCAAGCTATGGCTAATGGCTACTTANCCATGTGACCCNNAAGGAAAAAAAAANTCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165709666..165709967 288
 
EST/CDNA Est Name
  AK003657.1


Sequence tag IST14713D11HMR1
Sequence
AGCCNAAGGTCTTCTCCCAGCACAGTTNNGGACTGCCTGTGGCAGAGAGCAGAGCAAGCCAGCTTGCTTCTCCAGAGCGG
TTCTGGGAAAGGCTGGGCTAAGTTCTGACAAGAGAGGATGCGTGTTTGCACCAGAAGTCAGGCCTGAACAAGAACAGTAC
TCAGGGACCCAGGCTGGTTCCTGGGCCTAGGTGGGTGGTGNCNTGNGC
Sequence Type genomic DNA
Unitrap ID UNI29769

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165709463..165709662 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es