Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15103D2
Clone ID IST15103D2
Vector VICTR80
Project tigm

Sequence tag IST15103D2HMR1
Sequence
NNNNNNNNNTNNNCNNNNNNNNNANTTTTGNCTNNNNNGTCTTTGAGCATTANCCNCANCTGANTTCNTGATGCCNTTAN
NAATTTTTACTAATTAATATTTTTGTTGTGTATGCNNTGATTACTTTCTGGGATGACATGTTNANTNNGGGANAGCTGTC
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15103D2BBF1
Sequence
AGGCCAAGTCTGGTAAAGTGGCACATACCATAATCTCAGCACTTGGAAGGCAGCATGAGGAATTCAAGTTCATCTTCAAC
TGCATTGAAAGTCTGAGGCAGCCTAAGCTACATGAGATCCAGTGTCAAAAAATAATAGTAGTAATAAAAAGAGGAAGAAG
CAGCCGCGCATCCTTTAGCCATCACATTATAGTCCCATCATGGCTAACCTCAAGTAATCACCTGCCCCCTCGCAGTCTCT
ATAGACTACTTATTGCAGGTATTTCCTATGCTTGGGAGCAGACAATATGTGGTTCTTTCACTGAGCACAATGTTTTCNAG
GTTCACTCACATGCTAGCAAGCAACTCTTTATTCCTTTCTACAGCAGANTAATGGACCNAGANACAGGGATGTCATATTT
ACTCATCTGTTCATTTGCTGATGGACATTAANANTTATTTTANTTTTTTCTTANTTTTGTTTTGTGACAGGGATCTCTAT
GTATNCCN
Sequence Type genomic DNA
Unitrap ID UNI21090

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69501482..69501968 469
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018752 (Tnfsf12) NM_001034097 tumor necrosis factor (ligand) superfamily, member 12 Gene [Source:MGI (curated);Acc:Tnfsf12-002]


Sequence tag IST15103D2HMF2
Sequence
AGGCCAAGTCTGGTAAAGTGGCACATACCATAATCTCAGCACTTGGAAGGCAGCATGAGGAATTCAAGTTCATCTTCAAC
TGCATTGAAAGTCTGAGGCAGCCTAAGCTACATGANATCCAGTGTCAAAAAATAATAGTAGTAATAAAAAGAGGAAGAAG
CAGCCGCGCATCCTTTAGCCNTCACATTATAGTCCCATCATGGCTAACCTCAAGTAATCACCTGCCCCCTCGCAGTCTCT
ATAGACTACTTATTGCAGGTATTTCCTATGCTTGGGAGCAGACAATATGTGGTTCTTTCACTGAGCACAATGTTTTCAAG
GTTCACTCACATGCTANCAAGCAACTCTTTANTCCTTTCTACAGCANANTAATGGANCANNANACAGGGATGTCNNATTT
ACTCATCTGTTNNNTTGCTGANGGACATTAANAGTTATTTTATTTTTTC
Sequence Type genomic DNA
Unitrap ID UNI21090

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69501521..69501968 414
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018752 (Tnfsf12) NM_001034097 tumor necrosis factor (ligand) superfamily, member 12 Gene [Source:MGI (curated);Acc:Tnfsf12-002]

 
Come back to gene ENSMUSG00000018752


For any suggestions or comments, please send an email to unitrap@crg.es