Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST436064
Clone ID OST436064
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST436064
Sequence
TGAGGGCAGACTATTCGAGANTAAGGATTGTAGAAGCAGCGAACAGAAAAGAGGTAGACTATGAAGCAGGAGACATCCCA
ACCGAGTGGGAAGCATGGATTAGAAGAACAAGGAAGACTCCACCCACTATGGAGGAAATACTAAAGAATGAAAAGTACAG
AGAAGAAATTAAAATAAAAAGCCAAGATTTTTATGAAAAAGATAAACTCGGTAAAGAAACCAGNGAAGAACTCTTGCCTT
CACCTACTGCAACTCAAGTTAAAGGGCACGCCTCTGCCCCGTATTTTGGAAAGGAAGAGCCCTCAGTGGCTCCCACCAGC
ACTGGCAAGACTTTTCAGCCAGGATCCTGGATGCCAGAAGATGGCAAAAGACAAAGTCAATGAATGACAAAGTCAATGAA
TGCCCTGCCCTGAAGTCATAGCATTGTAAGGATATGGCTGTTTTAACAAATAAAAGGTTAAAAGTCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI5670

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 108842785..108881819 263
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068184 (Ndufaf2) NP_001120818 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 2 Gene [Source:MGI Symbol;Acc:MGI:1922847]

 
Come back to gene ENSMUSG00000068184


For any suggestions or comments, please send an email to unitrap@crg.es