Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10315B5
Clone ID IST10315B5
Vector VICTR76
Project tigm

Sequence tag IST10315B5BBF1
Sequence
ATGCCTCATACAAATCAGATGTCCATTTGTTACTGTGTTTGTTAACAACCCTTTATCTCTTANTGTTATAAACTCCACTT
AAAACTGATTAAAGTCTCATTCTTGTAAAAAAAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 97727313..97727426 108
 
EST/CDNA Est Name
  AA450527.1


Sequence tag IST10315B5HMF1
Sequence
ATGCCTCATACAAATCAGATGTCCATTTGTTACTGTGTTTGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI30919

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 97727381..97727426 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32897707..32897752 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 66347645..66347690 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038664 (Herc1) hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1 Gene [Source:MGI (curated);Acc:Herc1-001]

 
Come back to gene ENSMUSG00000038664


For any suggestions or comments, please send an email to unitrap@crg.es