Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14156F8
Clone ID IST14156F8
Vector VICTR74
Project tigm

Sequence tag IST14156F8BBF1
Sequence
ATTATATCTAAGTACACTGTAGCTGTCTTCAGATGCACCAGAAGAGGGTGTCAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI36493 UNI36494 UNI36495

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 36315338..36315395 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 7900125..7900182 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69438860..69438917 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 60214785..60214842 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 8722401..8722458 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052551 (Adarb2) NP_443209 adenosine deaminase, RNA-specific, B2 Gene [Source:MGI Symbol;Acc:MGI:2151118]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26754664..26754721 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 6427403..6427460 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022149 (C9) NM_013485 proteasome (prosome, macropain) subunit, alpha type 4 Gene [Source:MGI (curated);Acc:C9-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22294672..22294729 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15229368..15229425 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 35780773..35780830 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30786382..30786439 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 62074359..62074416 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066148 (Prpf4) NM_027297 PRP4 pre-mRNA processing factor 4 homolog (yeast) Gene [Source:MGI (curated);Acc:Prpf4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 73583690..73583747 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 31602105..31602162 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13539556..13539613 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 74074621..74074678 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 88506419..88506476 58
NO GENE  

 
Come back to gene ENSMUSG00000066148


For any suggestions or comments, please send an email to unitrap@crg.es