Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11041E6
Clone ID IST11041E6
Vector VICTR76
Project tigm

Sequence tag IST11041E6BBF1
Sequence
ATCATAATTAGAATGAGTTTTCCCACCTCACCTAACCCAATCTGAAACTGTCATCACACAGGTGCCCAGAGCTTTGTCTC
CTAGGTGATTGAAGGACTTGGGAGGCTGGCAGTCGGAATTAACCCTCACACAGGGAAGGGGAAAGCAGTTACTCCTGAGA
GTTAAGTGACAGAAGAAAGCTTCAAGGCTCCCTGCAGCCTGTGAGGAGCAGGTCTGGGCTCCAGGGTGGGGACCCTGGCT
GGGAGGTGGCCACTATGTCCAGTGGGCTACCAGGGGGCGATACAATTTGCCTTAAACAGCTTGAAAGCCCTGGGGCCCTG
GCTAATTCACAACACCCAGGGCTACAACACCCAGGGCTTTGTGCTTCTCTCTTAAAATAAAACTTTTATCTTAAAAAAGA
AAAGGCATCCNACACAGAGTTTTCTGACCGCAGCGGCAGGCTAGATCTG

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 82983649..82984096 446
NO GENE  


Sequence tag IST11041E6HMF1
Sequence
NCATAATTAGAATGAGTTTTCCCACCTCACCTAACCCAATCTGAAACTGTCATCACACAGGTGCCCAGAGCTTTGTCTCC
TAGGTGATTGAAGGACTTGGGAGGCTGGCAGTCGGAATTAACCCTCACACAGGGAAGGGGAAAGCAGTTACTCCTGAGAG
TTAAGTGACAGAAGAAAGCTTCAAGGCTCCCTGCAGCCTGTGAGGAGCAGGTCTGGGCTCCAGGGTGGGGACCCTGGCTG
GGAGGTGGA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 82983848..82984094 247
NO GENE  


Sequence tag IST11041E6HMR1
Sequence
TTTTNNNNACAGGGTTTCTCTGTATAGTCCTGGCTGTCCTGGAACTCACTTTGTANACCAGGCTGGCCTCGAACTCAGAA
ATCCACC
Sequence Type genomic DNA
Unitrap ID UNI2208 UNI30239 UNI31972 UNI32236 UNI36496 UNI36497

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 21888672..21888750 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028033 (Kcnq5) NM_023872 potassium voltage-gated channel, subfamily Q, member 5 Gene [Source:MGI (curated);Acc:Kcnq5-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 96780507..96780585 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 83964868..83964946 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051452 (OTTMUSG00000000997) NM_001037932 predicted gene, OTTMUSG00000000997 Gene [Source:MGI Symbol;Acc:MGI:3650287]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 40965147..40965225 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021360 (Gcnt2) NM_133219 glucosaminyl (N-acetyl) transferase 2, I-branching enzyme Gene [Source:MGI Symbol;Acc:MGI:1100870]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55235825..55235903 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 61407331..61407409 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 21511863..21511941 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 18940300..18940378 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 13341094..13341172 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026726 (Cubn) NM_001081084 cubilin (intrinsic factor-cobalamin receptor) Gene [Source:MGI (curated);Acc:Cubn-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 84343846..84343924 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074513 (Arfip1) NM_001081093 ADP-ribosylation factor interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1277120]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 11087476..11087554 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 38650965..38651043 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 149081519..149081597 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29949290..29949368 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037239 (Spred3) NM_182927 sprouty-related, EVH1 domain containing 3 Gene [Source:MGI (curated);Acc:Spred3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 131328921..131328999 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 108369720..108369798 77
NO GENE  

 
Come back to gene ENSMUSG00000037239


For any suggestions or comments, please send an email to unitrap@crg.es