Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10748G6
Clone ID IST10748G6
Vector VICTR76
Project tigm

Sequence tag IST10748G6HMF1
Sequence
ATAAAAGCCTTCAGGCGGTTCACTCCCTTTGATCTTACCCANAAGATCAGTGGA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 41034984..41035036 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 74180251..74180303 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 160489074..160489126 51
NO GENE  


Sequence tag IST10748G6BBF1
Sequence
GAGGTACCAGGAAAGGGAGAACAAGTCAGGTGTGGTGCCTTTAGTCCCAGCCCTCTGGAGATGGAGGCAGGCAGATCTG

Sequence Type genomic DNA
Unitrap ID UNI13115

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71157110..71157187 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003279 (Dlgap1) NM_177639 discs, large (Drosophila) homolog-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1346065]

 
Come back to gene ENSMUSG00000003279


For any suggestions or comments, please send an email to unitrap@crg.es