Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11320C10
Clone ID IST11320C10
Vector VICTR76
Project tigm

Sequence tag IST11320C10BBF1
Sequence
GTTCCNGAAGCCTGTACTCTATTCAGTTTATCACAGATCATTTCGCACCATTACCAANAAGCTAGGATGGAGTCTCCTGG
CAGCCCCCAATCTTAATACGGCTTGGTGCAAAAACATGCTCCCCAAATTCCTAGCAAACTACAANCTTTAAGCAGTCCAG
GAAGGGACAGGCTTANTGATCCAGGAGTTACAGGGACAGCTGCTCTTTCCCACTAANATACCAAATCTTACAGATGGGGA
TACACCCCGAGGACTTGACACNTCCAGTTGTTTTNATCATTTTCCTGATTCANTGATTCAAAGCTAAGTTTCCCACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42279641..42279956 300
 
EST/CDNA Est Name
  BB847425.1 - CJ184554.1 - CJ184895.1 - BY129926.1 - BY153129.1 - CF538084.1 - BY365912.1


Sequence tag IST11320C10HMR1
Sequence
AACTACTAGGAAGNCAGTCTGGGATTTGGAGAAGGGAAGAGGATTCGTCCTCCTTAGGGACACAGGCAGCAATTGCAGAA
GTTGTAGTTGAGGAAAAGTTGATTGGAGGAGTTGAACTGTTC
Sequence Type genomic DNA
Unitrap ID UNI29651

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42279523..42279643 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037287 (Tbcel) NM_173038 tubulin folding cofactor E-like Gene [Source:MGI Symbol;Acc:MGI:1925543]

 
Come back to gene ENSMUSG00000037287


For any suggestions or comments, please send an email to unitrap@crg.es