Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10147E4
Clone ID IST10147E4
Vector VICTR76
Project tigm

Sequence tag IST10147E4BBF1
Sequence
AATGGTAGGCCAGGTAGAGTTAAGCACAGACCTAAAGGAGCGAAGGAAGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI11447

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21656281..21656336 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032198 (Dock6) NM_177030 dedicator of cytokinesis 6 Gene [Source:MGI Symbol;Acc:MGI:1914789]


Sequence tag IST10147E4HMF2
Sequence
GGCACAATCAGCTTCTCTAGTCTCCAAGTTCTCGTGCTGGTTGAGAGTCCCATAGTTGGTATCTATGCAGAACTGCGGTC
CCATCCTTATAGCACCACAAAGGCACCAACCAAAAATGGCGACTTGGAAGCTCTCCGAGGCCGTCGGTTACCGGTCACGC
TCGTGAAAGAGATGAGTCGTAAAGAAACATCTAGGACAGGGATTCACGCCGTGGTAGGGGACGCAGAGTAGACCCACGCC
ACCAGCAAGCCACACAGAGCAGAAAGCCCGACCTGCCAAGCCAGGCGCTGGGCTCACAGTCCTACCACGTGTTGTAGTAC
CATCTGCGCCTGCGCTAGTGAGGCGCGCGCCCGGCGGCCGGAAGAGCCGCGCGTTTCCGGGTTGGAGGCGGGGAGCGGTG
CCGGAAGTGCTTGGGGAGGGCCGCGCAGTCGGACCGGCTGCTGAGACGAAAGCTTCACTGGGGCAGTCTCCGCATATCAT
GGGGAGATAGACGCTGCTGCCTGTGAGTCTTGGGCCCTGGCAGTTGAGGACGAAAAGCGGGAA
Sequence Type genomic DNA
Unitrap ID UNI10755

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 131829901..131830442 540
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028899 (Taf12) NM_025579 TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI (curated);Acc:Taf12-001]

 
Come back to gene ENSMUSG00000028899


For any suggestions or comments, please send an email to unitrap@crg.es