Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST435847
Clone ID OST435847
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST435847
Sequence
AATGGCCCTGAGCCTGGAAGATTCTGAAGGGGTTTACTTTGTTCCGTCGTTTAGTGGATTACAGGCTCCATTAAATGACC
CCTGTGCCTGTGCCTCTTTTATGGGTTTGAAGCACTCCACTAATAAATACCATCTTGTCCGAGCAAAATAAAAAATCAAT
AG
Sequence Type mRNA
Unitrap ID UNI5014

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96071910..96075205 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041440 (Gk5) NP_796326 glycerol kinase 5 (putative) Gene [Source:MGI (curated);Acc:Gk5-001]

 
Come back to gene ENSMUSG00000041440


For any suggestions or comments, please send an email to unitrap@crg.es