Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14603F11
Clone ID IST14603F11
Vector VICTR74
Project tigm

Sequence tag IST14603F11HMR1
Sequence
AGACTCTNAGCCNATGTGGTCNAGAGCCACTGCTCTCCAGGAAGATGGCAGAAGCCTGCCTCAGCCGCCTANANAAACAG
AGACTTGTAGAAAAGACTTGCAGAGAGTGACAGCTGGGAGGGGCCTAGGAT
Sequence Type genomic DNA
Unitrap ID UNI17535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 12875157..12875287 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031442 (Mcf2l) NM_178076 mcf.2 transforming sequence-like Gene [Source:MGI (curated);Acc:Mcf2l-009]


Sequence tag IST14603F11HMF1
Sequence
GTCTGAGGGATCAGGTCCCAAGTTTTGGCTGGGGAATCGCATGCAGGGCAACCTCGCCTTAGCCTGCAGGGCTCTGGAGG
CCAGAAAGGCAAGGAACAAAGTGGAGGTTCTCTTGCTGAAGCTGACCAAGGCTGTGGCAGAGCTTTGAAACCCTCCTCTG
CAATCTTAGGTCTTAAAACCAGCTTTGAGACAGACAGGCCACTGGAGTTCACTTTAGAAATCCTCACCAGAGCCCAGAGG
CTCCTCATCCAAGATAGCACCCCACTCTTACGTGACCAAGTGGTATCCTGCTGACTGGAANANAGGACCATGACACACCC
CACCCCCAGCCNCCAGGGAGAAGGGGTGGTACCTTATTTTGGTGGTGACCTGATGCCNGGGCCACACATCCTGGGGCCTC
CCACNGCCTCNAAGCNCATCCTTTGGCANCTGGGCATCATAACCCTCACTGNCCCNAAGCTTGNCANCTGTTTGGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 12874684..12875160 453
NO GENE  

 
Come back to gene ENSMUSG00000031442


For any suggestions or comments, please send an email to unitrap@crg.es