Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14529E3
Clone ID IST14529E3
Vector VICTR74
Project tigm

Sequence tag IST14529E3HMF1
Sequence
TCACCAAAGCCGCCCTCTTCAGTAAGCAGTGATGCAAGCCAGACAAGATGTCGGTACAGAAAAATGCTGTTGCCNAACGC
CTTACTTTTGGGATCTCATCTGAAGTGGGCCTGAAATAACCTAAGTGTAACTATCCAGAANAAATGGCCTTANGAGCCNG
TGGGGAGTANGGAAGGGGCCCAGANAGGANCAGCAGGTATGATGGAGGCTGTGCATTCCTCAAAACCCATCACATGCTCT
NNGNNNCNGCTGTTTATTCCATAATATCCCGAGAACAGCAGCCATGTGCANGGCNGCTGGAACTCCCTGGGGCCCCTANG
GCTCTCANCTTCCTACACAGCAACCNTGGGCACANGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14529E3HMR1
Sequence
NGATGCAGGCNTGGGTGTTCAGTGATAAAATGGGGGTNACTTCTCTGGGGGTGGAAGCTGCCCCANAATTGGGATGGGGA
CAACCCCCTTCCAGTGACTGCTGGACAAGGGCCCCTAA
Sequence Type genomic DNA
Unitrap ID UNI36505

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4301374..4301489 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024858 (Adrbk1) NM_130863 adrenergic receptor kinase, beta 1 Gene [Source:MGI Symbol;Acc:MGI:87940]


Sequence tag IST14529E3BBF1
Sequence
TCACCAAAGCCGCCCTCTTCAGTAAGCAGTGATGCAAGCCAGACAAGATGTCGGTACAGAAAAATGCTGTTGCCAAACGC
CTTACTTTTGGGATCTCATCTGAAGTGGGCCTGAAATAACCTAAGTGTAACTATCCAGAAGAAATGGCCTTAGGAGCCAG
TGGGGAGTAGGGAAGGGGCCCAGAGAGGAACAGCAGGTATGATGGAGGCTGTGCATTCCTCAAAACCCATCACATGCTCT
CGGCTCCTGCTGTTTATTCCATAATATCCCGAGAACAGCAGCCATGTGCAGGCAGCTGGAACTCCCTGGGGCCCCTAGGG
CTCTCAGCTTCCTACACAGCAACCTGGGCACAGGANAANCTGCGGCAGANTCTATGCCTGCTCTTGACGTCNCCCAGGGT
TNACTACAAGCGTGGATTGTGCATTAATNGNACACATCATTCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4301488..4301931 430
 
EST/CDNA Est Name
  CX225694.1 - BG175380.1 - BF101010.1 - BE373984.1 - BF122036.1 - BQ713026.1 - CX231943.1 - BX512973.1 - AW763140.1 - BY270881.1 - BY197199.1 - BY048212.1

 
Come back to gene CX225694.1 - BG175380.1 - BF101010.1 - BE373984.1 - BF122036.1 - BQ713026.1 - CX231943.1 - BX512973.1 - AW763140.1 - BY270881.1 - BY197199.1 - BY048212.1


For any suggestions or comments, please send an email to unitrap@crg.es