Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10903F4
Clone ID IST10903F4
Vector VICTR76
Project tigm

Sequence tag IST10903F4HMR1
Sequence
TCTTAACATGAGCATCTTTTATGAGGTTATTGGTATTTCCCATTGTTTTACACACTCCCTTCTTGAGTCTAACAATGCCA
TCTGAGGTCCCCAGANAGTCCAGAGGGGGCCTCACAATGCATTCACTTAGGGATGAGCGGTGAGGGGCCTGCTTCTTCTA
GCAGCTGCTGGTCCTAGGATAGAGTGAGCTGGAATCCCTGTACCAGTAATGTTCAAAGGTCATTAGGTGGCTACAAGGGA
AATCAATTTTGCAAAATGCCNTTTCGCTCANTTCTGACACTGCTTAACTTTGCTTTACNNTTGGCNNNTAANCTGGGANA
NGCNGANTGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114499545..114499874 304
 
EST/CDNA Est Name
  CX219981.1


Sequence tag IST10903F4HMF1
Sequence
AAGAAGCTTGGTTTTTACTCTGCATANTANAGGCTAATTCTCTTTATCCCGAACAAAAACAGCCTCTGTGTCCATTGAGA
CACTAGAATATTCTGGAAAGATCACGAAACAGCTCACTGAAAAGA

Sequence Type genomic DNA
Unitrap ID UNI35790

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114499425..114499548 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031949 (Adat1) NM_013925 adenosine deaminase, tRNA-specific 1 Gene [Source:MGI (curated);Acc:Adat1-002]

 
Come back to gene ENSMUSG00000031949


For any suggestions or comments, please send an email to unitrap@crg.es