Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12990G10
Clone ID IST12990G10
Vector VICTR76
Project tigm

Sequence tag IST12990G10HMF1
Sequence
TTATTTATTTATTTATTATATGTAAGTACACTGTANCTGTCTTCANACNCNCCNNAAGAGGGCNTCAGATCTCATTATGG
GTGGTTGTGAGCCNCCATGTGGTTGCTGGGATTTGAACTCTGGACCTCCGGAAAANCANTCGGGTGCTCTTACCCNCTGA
NCCATCTCACCAGCCCCCCATCCTTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTC
NTTCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12990G10BBF2
Sequence
TTATTTATTTATTTATTATATGTAAGTACACTGTANCTGTCTTCANACGCACCAGAAGAGGGCATCAGATCT
Sequence Type genomic DNA
Unitrap ID UNI878 UNI3468 UNI15793 UNI35277 UNI36506 UNI36507

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84968241..84968312 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4171345..4171416 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 78378773..78378844 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 67872879..67872950 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034912 (Mdga2) NM_207010 MAM domain containing glycosylphosphatidylinositol anchor 2 Gene [Source:MGI Symbol;Acc:MGI:2444706]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 34883329..34883400 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 57490548..57490619 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 8146269..8146340 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039801 (2410089E03Rik) RIKEN cDNA 2410089E03 gene Gene [Source:MGI Symbol;Acc:MGI:1920942]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17584369..17584440 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 63787610..63787681 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023965 (Fbxl17) F-box and leucine-rich repeat protein 17 Gene [Source:MGI Symbol;Acc:MGI:1354704]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 77141007..77141078 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 37050017..37050088 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29538360..29538431 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039844 (Rapgef1) NM_054050 Rap guanine nucleotide exchange factor (GEF) 1 Gene [Source:MGI (curated);Acc:Rapgef1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 51230360..51230431 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063273 (Narg1) NM_053089 NMDA receptor-regulated gene 1 Gene [Source:MGI Symbol;Acc:MGI:1922088]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 52949963..52950034 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 23680533..23680604 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 51551147..51551218 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29213867..29213938 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 49061863..49061934 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031563 (Wwc2) NM_133791 WW, C2 and coiled-coil domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1261872]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 53470943..53471014 68
NO GENE  

 
Come back to gene ENSMUSG00000031563


For any suggestions or comments, please send an email to unitrap@crg.es