Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12285A8
Clone ID IST12285A8
Vector VICTR76
Project tigm

Sequence tag IST12285A8HMF1
Sequence
TTAGGAACCCTGGAATATTTTGGAGAGGGGACCAGAGAAGGCCCATAAATTCCCAGCCTCACCCATACACCCCTGCACAC
ACACACACACACACACACACACACAT
Sequence Type genomic DNA
Unitrap ID UNI12510

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22412265..22412368 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]


Sequence tag IST12285A8BBF1
Sequence
TTAGGAACCCTGGAATATTTTGGAGAGGGGACCAGAGAAGGCCCATAAATTCCCAGCCTCACCCATACACCCCTGCACAC
ACACACACACACACACACACACACNNATNTG
Sequence Type genomic DNA
Unitrap ID UNI12510

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22412266..22412368 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]

 
Come back to gene ENSMUSG00000013089


For any suggestions or comments, please send an email to unitrap@crg.es