Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14508H10
Clone ID IST14508H10
Vector VICTR74
Project tigm

Sequence tag IST14508H10HMR1
Sequence
TCCNCCTGCTTCTGCTTCCCAGGTGCTGGGATGAAAGGCGTGCGCCACCACTGCCCAGCTTGGCACACACTTTTAACCCC
AACACTCTGAGGGCAGAGGCAGGATCTCTGTGAGTTTGAGGCCAGCCTGGACTACATAGTGAATTCCAGGACAGGCAGTG
CTACACANANAAATCCTATCCTGAACANNAAACAGAGGAGTGGGGGAGGATGGGGGATATATGTTTATATGAAATGACTT
AATTATATCCTTAAAAATGANATGCANAATATTAAGTGTTGANNACTGTTTGAGTAANTCN
Sequence Type genomic DNA
Unitrap ID UNI21197

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123443318..123443617 280
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056735 (A930024E05Rik) RIKEN cDNA A930024E05 gene Gene [Source:MGI Symbol;Acc:MGI:1924414]


Sequence tag IST14508H10BBF1
Sequence
GTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTA
Sequence Type genomic DNA
Unitrap ID UNI14865 UNI30899 UNI31276 UNI31415 UNI31902 UNI32547 UNI32548 UNI34366 UNI34418 UNI36509 UNI36510 UNI36511

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4750330..4750363 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 3143178..3143211 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015202 (Cnksr3) NM_172546 Cnksr family member 3 Gene [Source:MGI Symbol;Acc:MGI:2674130]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3063485..3063518 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023764 (Sfi1) NM_030207 Sfi1 homolog, spindle assembly associated (yeast) Gene [Source:MGI (curated);Acc:Sfi1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3183860..3183893 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3046728..3046761 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8600490..8600523 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058570 (AC129222.4-202) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q3TZ95]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 3221663..3221696 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3553372..3553405 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3134847..3134880 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3296476..3296509 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3365071..3365104 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024900 (Cpt1a) NM_013495 carnitine palmitoyltransferase 1a, liver Gene [Source:MGI Symbol;Acc:MGI:1098296]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3198512..3198545 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 3871875..3871908 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 3380963..3380996 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3154528..3154561 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 3934393..3934426 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3105246..3105279 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3182479..3182512 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005534 (Insr) NM_010568 insulin receptor Gene [Source:MGI (curated);Acc:Insr-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3237151..3237184 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_109319: 93727..93760 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_110857: 26352..26385 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_162750: 15283..15316 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 43459..43492 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166280: 93323..93356 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166281: 132958..132991 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166283: 28487..28520 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166286: 6987..7020 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166291: 36674..36707 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166303: 114808..114841 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166308: 11242..11275 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166313: 47389..47422 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166323: 51650..51683 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079302 (CAAA01125558.1.1.41745-202) NP_780747 Serine/threonine-protein kinase NIM1 (EC 2.7.11.1) [Source:UniProtKB/Swiss-Prot;Acc:Q8BHI9]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166326: 109113..109146 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166327: 2834..2867 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166334: 3626..3659 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166347: 421170..421203 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166417: 80632..80665 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166434: 20961..20994 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166435: 36455..36488 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079073 (AC124606.3)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166436: 210886..210919 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166437: 49913..49946 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079060 (AC126241.4)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166438: 85243..85276 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073511 (AC140325.3-202) NP_001116150 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q3UL33]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166440: 139781..139814 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079214 (AU018829) NP_001026793 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q3UL49]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166441: 200284..200317 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079831 (AC170088.9)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166449: 14596..14629 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166455: 17720..17753 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 4489734..4489767 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 133063..133096 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053211 (Zfy1) NM_009570 zinc finger protein 1, Y linked Gene [Source:MGI Symbol;Acc:MGI:99212]

 
Come back to gene ENSMUSG00000053211


For any suggestions or comments, please send an email to unitrap@crg.es