Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14682F4
Clone ID IST14682F4
Vector VICTR74
Project tigm

Sequence tag IST14682F4BBF1
Sequence
CTGACTTCTTGCAATTTGTGCCCTAGCCTAGGCAGCAGACACTAGGGGATCTGTGATTCAGCTGAAAGCCTCTGGAATTA
CAGACTGCTTACTAATTCTCACCAAAATAATTATCCGTCATCTAGGTTCTAATCTCTCTCAAAGGATCGCCCTCCATGTA
AGCTCTGGCATCGTGCTGAGAGACATGCATGCAGGACTAACTATTGAGTGGGCACAGGGAACCATGGGTACTTAAGGATC
TACAGACTCGGAGGATCTCTGTGGGAGATGCCTGCAGTTTTAGGTCTCCTGCAGACCCGCAGGGGTACCATGCAACGTCC
TTCCTCTTCANGCTCTGCTCCTGANCATANATGACCCCNTNNCTGAAACTGTCCCTGGTTCCTTTTCNNGCTGGTTGATC
ACTCTTTCTGTANTGACTCANCACTTCNCTCTGTAAACACNNTCNCCTCAAAAGTNACCTCTCTANNNNGAAGGTGACGT
AGTCCCTGAAANGTTGAGGAGTTNNANANCNNGNNNNNAANATCTCATGNNNCTGGCNTNNCNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14682F4HMF2
Sequence
CTGCAAGTAGACCAGCTTCAAAGTTGGTCAGTGAACTCAACCTTATACCTGTCCCTCTTTATTTGTAATCCCCTAATTTG
TAACCCTGTAACCCAGGGAGGTTAGACAACACTCATTCCCTGGTGTCTTTTGTCTCACTGATCAGTCAGAACCCAGCCTG
AAAGCAGTTGTAGGACTGTTTTCCAAGCCCTGGGCAGCAGAGGCTGGAAGAGGAGTTCAAAGCAAGTTTTAACTACATGA
CATAAAGAAAGTAGGAGCTACAGGAGATGTTTCTCTAAACAGACAGATATGAAATCTCTTTAAAAATAGGAATGAAATTC
TTAATTTGGGGGAAATATTGGAGAATAGAAACACGTAAGACGTCNAATCACCTATGCATAATGAAAATGANATTCNNANN
AGTNATACCAAANTTTAATATTTAAAAANANCAATATNNTTGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 175547167..175547609 419
NO GENE  


Sequence tag IST14682F4HMR1
Sequence
GCAGCACAGAAAAGGAGGAGGAATAAGGTAGGTGAGGCCTTTCTGCTTTGGCAGTGGTTC
Sequence Type genomic DNA
Unitrap ID UNI15567

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 175547606..175547664 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078893 (BX890623.7-202) Novel KRAB box and zinc finger, C2H2 type domain containing protein [Source:UniProtKB/TrEMBL;Acc:A2ARL5]

 
Come back to gene ENSMUSG00000078893


For any suggestions or comments, please send an email to unitrap@crg.es