Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13431C7
Clone ID IST13431C7
Vector VICTR74
Project tigm

Sequence tag IST13431C7HMF1
Sequence
ACATGAGCCCAGAAGAACAAGACTAGACTCCACTCTAAGGTTGCCAAGGGTGTACATGAGGCCCGTGTTCCAGTCCTGAG
AACTCTTTGAAAGACACCCCAGGCCTGCTCTCCTGAATCAGTGTGCCAGACCAAGGTCTGACATCTGCTTATTGCCATCC
CCGTGATTTTGAGTGAGATAGTTC
Sequence Type genomic DNA
Unitrap ID UNI36514

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 50276869..50277022 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039316 (Rftn1) NM_181397 raftlin lipid raft linker 1 Gene [Source:MGI (curated);Acc:Rftn1-001]


Sequence tag IST13431C7BBF1
Sequence
ACATGAGCCCAGAAGAACAAGACTAGACTCCACTCTCAAAAAGCAAAACCAAACAAAAGTTCATACAGCATGTTTAGGCT
GCTGTTATGTGAAATGGAGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87363750..87363849 100
NO GENE  

 
Come back to gene ENSMUSG00000039316


For any suggestions or comments, please send an email to unitrap@crg.es