Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST435514
Clone ID OST435514
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST435514
Sequence
GAGGAGCAGACTCGAATCACTCAAAGAAGATATTAAGGAATTCTTTAAAATATCAGGTTGGGAGAAGAAACTTCAGAATG
CTGTTTATAGTGAACTGAATGTGGGGTTGCTTACATGTTTCCGAGGGCGAGTTCATGGCCATCTTGGNGGGGACCAANAC
AGCAGGNGGACTGGCACAGTGTTGGAGTAATAGTTGAGACCTTATACCCGAAGCATANGGCCAAGGTTTCCTTTGCCAAG
TCATCCTTNTGCACCCCCTGAGCATCTCAAA
Sequence Type mRNA
Unitrap ID UNI17824

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 54220609..54224254 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039178 (Tbc1d19) NM_144517 TBC1 domain family, member 19 Gene [Source:MGI Symbol;Acc:MGI:1914499]

 
Come back to gene ENSMUSG00000039178


For any suggestions or comments, please send an email to unitrap@crg.es