Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15059C5
Clone ID IST15059C5
Vector VICTR80
Project tigm

Sequence tag IST15059C5HMF2
Sequence
CGCTAACCTCAAAGAGGCTCAATGAATACTTGTGCCTTCTCCTCCCTCAGAGAGGAAGGGAACCGACCAAAGGTGCTGGG
GGGGGGGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117211667..117211753 87
NO GENE  


Sequence tag IST15059C5HMR1
Sequence
CTCAAAATTAACTACAATGAGCAAATACTCAGAATGTACTTGTATTTTATTTTAGACATTTAGAATTTGGTAATAGTGTT
AGCTTTGAAAAATACCTTTCCTGGTCATTTTTGTTTTGTAATGACTTACATAGAGTGCTTTATGCATCAAACATATGGTC
GAAAAAGGTCACATGTATCACGCAGGCCCTCAATCCAAGAAAAACAGAACAGGTTCAATGTGTGTGGTGTCTGTGCAGGG
GTAAGTTAATGTATGGTTC
Sequence Type genomic DNA
Unitrap ID UNI278

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 30920349..30920606 258
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037643 (Prkci) NP_032883 protein kinase C, iota Gene [Source:MGI Symbol;Acc:MGI:99260]


Sequence tag IST15059C5BBF1
Sequence
CGCTAACCTCAAAGAGGCTCAATGAATACTTGTGCCTTCTCCTCCCTCAGAGAGGAAGGGAACCGACCAAAGGTGCTGGG
GGGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117211669..117211753 85
NO GENE  

 
Come back to gene ENSMUSG00000037643


For any suggestions or comments, please send an email to unitrap@crg.es