Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13025D2
Clone ID IST13025D2
Vector VICTR76
Project tigm

Sequence tag IST13025D2BBF1
Sequence
CTATAACANAATTTCCAGGGCAGGCTCCTNANTACATTGTNTTTTTCTTTTCTCCAAAGTACTGTGTTTGGTGTATTGTG
CTNANACTTCTAGCTGCCTTTANCANATGTCTCANTATGTGGATTTCCTAATTTTACTACAGGGTTGTCTGTGCCATGGC
TGAATTCTACATAGATATCCANCAATCATACCGCCNTANCNNNNNCTGANCTCCTCTGANGCACTCCTCATGANAGGAAA
CACGTTGGGTCCNCACTGTACCCAATAAAGCCNTTATTCTATCAACTGTCACATGGTATCGTCCCTCATTTGTGAGTTTT
TGTCTCTCCNAATAATCNGCAGANGAAGANGGNAAAACATATATGANTTTTATNAACTTTGAATCTGGAGCCCAAGTTCC
AAGTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13025D2HMF2
Sequence
ATCTGAAGGCTGCTAGTANAATACTGTCTTCCAGGAAGCTAGAAAAAGGGTCTTAAAGCCCACGCCCACAGTGACACACC
TACTCCAACAAGGCCAAACATCCTAATAGTGCCACTCCCTGGGCCAAGCATATTCAAACCACCACAGAAAGTGAAAGGGG
CAGGGGTTGTCATACCAAAATGGAAGATTGAGGACAAGTGTCTGCCTTCCCTTCCAACCCCTATCCAAACCTAATAAAAA
CCATAGAGAACATCTGGGATCTGAGACAGGATCTCTTCCATCTCANGATNACCTCACACTTACTCTGAAGCTACAGAGCT
TCTGTTTCTGCCNCCTCCCCCTCNAGACTTTGGGCTCACCACTGTGGGCCTCCACATCNGGGTTTCTTGGTGCTGGGGAC
CCAACCCAGAACCTCTTGCACATCANGCAAGACTTCNCCNATCAAACTACATCACCAGCCTCAAATCTGANACTTCTAGC
AATTCCCTAAAN
Sequence Type genomic DNA
Unitrap ID UNI13763

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62642971..62643460 467
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020067 (Mypn) myopalladin Gene [Source:MGI Symbol;Acc:MGI:1916052]

 
Come back to gene ENSMUSG00000020067


For any suggestions or comments, please send an email to unitrap@crg.es