Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14345G7
Clone ID IST14345G7
Vector VICTR74
Project tigm

Sequence tag IST14345G7HMR1
Sequence
CTGGCAAGGGCCAGGGTGGCAAGAAAAGAGGTATGGGGTGGGGTGGGGACAAGAACTGGAGGTANCCTCTTTTTCCCCCA
GCAAAGGGGAGGGCTAGGGAGTGCATTCCTTTTGAGGTACCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25940155..25940275 119
NO GENE  


Sequence tag IST14345G7BBF1
Sequence
GCCNGGCCCCCACATTTTCATGTGATCAGCTCTGAGGCCAGAAGCTAAAACTCTATTTACACACCTCCAGACTCAAAGAA
AGAGGAAACACTCAGGAAGGGATGGAGAGATGGACAGAGCTGAATGCCTGTGGGAAGCACGGAGAGAAGCAGAGGACTAT
GGGAGGCCAGGAGCAGGAGACCTGTGGGCCTGGTGAGCGGCACAGACCTCTGCACTCGGTGGGATTCCCAGCAGGCCTCG
CTCCAAGCTCCCAGGGTTACTCTGAGGTCCGCCTATGTTGCGGATCANAGCTCTGAATTCTCAGCCTGCCTTAATTTGCT
GTGGGACTGTCCAGGATTCCAGGGACTCACGGATCT
Sequence Type genomic DNA
Unitrap ID UNI14695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25940271..25940625 351
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074274 (D930028M14Rik) RIKEN cDNA D930028M14 gene Gene [Source:MGI Symbol;Acc:MGI:3687343]


Sequence tag IST14345G7HMF1
Sequence
NNNNNGCCCCCACATTTTCATGTGATCAGCTCTGAGGCCNNAAGCTAAAACTCTATTTACACACCTCCAGACTCAAAGAA
AGAGGAAACACTCAGGAAGGGATGGAGAGATGGACAGAGCTGAATGCCTGTGGGAAGCACGGAGAGAAGCANAGGACTAT
GGGAGGCCAGGAGCAGGAGACCTGTGGGCCTGGTGAGCGGCACAGACCTCTGCACTCGGTGGGATTCCCAGCAGGCCTCG
CTCCAAGCTCCCAGGGTTACTCTGANGTCCGCCTATGTTGCGGATCANANCTCTGAATTCTCAGCCTGCCTTAATTTGCT
GTGGGACTGTCCAGGATTCCAGGGACTCACGGATCCTAGCCTGATAAAGGTGAGCTTTCTATTTCTCCCCTCCCCCACAT
CTGTAANCCCCACCCTGTGGGTNANANANACTCCCAAACTACNGCTGNTTCTACCCGCCCTGNCNGGANNCNCNNNCN
Sequence Type genomic DNA
Unitrap ID UNI16185

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25940276..25940738 433
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074274 (D930028M14Rik) RIKEN cDNA D930028M14 gene Gene [Source:MGI Symbol;Acc:MGI:3687343]

 
Come back to gene ENSMUSG00000074274


For any suggestions or comments, please send an email to unitrap@crg.es