Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13027A9
Clone ID IST13027A9
Vector VICTR76
Project tigm

Sequence tag IST13027A9BBF1
Sequence
CAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCACTCTGTAAACCAGGTTGGCCTTGAAATCACAAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI20380

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 38103623..38103699 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022812 (Gsk3b) NM_019827 glycogen synthase kinase 3 beta Gene [Source:MGI (curated);Acc:Gsk3b-001]

 
Come back to gene ENSMUSG00000022812


For any suggestions or comments, please send an email to unitrap@crg.es