Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12206A2
Clone ID IST12206A2
Vector VICTR76
Project tigm

Sequence tag IST12206A2HMR1
Sequence
NGTGAGGTTGCAAGATATAAAATCNGCTTATAAAGTACAATTAGTTGTTTTTACATAAAATAAGAATGAAATTCCAAGAA
AAACTATTTAAATATACCATCTTTTATAATAGTATCAAAGTTTAAAAAAAACACTTAGGAATATACTTAAACGAGTAAAT
GAAAGAATAATATAATCTATAAAGCACCAGCGAATCAGTAATGGAGAAAATGTACCAGAGCCTGGCTCGGGCCAATCTGA
AGGAGGCATTGCTCTTAATTGGTTCCTCTTCCCANATGGCNNGC
Sequence Type genomic DNA
Unitrap ID UNI19627

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 59769322..59769600 275
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021556 (Golm1) NM_001035122 golgi membrane protein 1 Gene [Source:MGI Symbol;Acc:MGI:1917329]

 
Come back to gene ENSMUSG00000021556


For any suggestions or comments, please send an email to unitrap@crg.es