Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14957F5
Clone ID IST14957F5
Vector VICTR76
Project tigm

Sequence tag IST14957F5BBF1
Sequence
GTCTCAAAAAAACAAAACAAAACAAAACAAAACAATGGACCAGTGGTAGAGGCACACGCTTTTAATCCCAGCACTTGGAA
GGCAGAGGCAGGCGGATTTCTGAGTTTGGGGCCATCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAG
AAACCATGACTCAAAAAAGAGGATGAAAAGGGATAGAGTGGCAAGATGGCCCAACAAGTTAGGGCAATGGCCACCAAGCC
TGACAGCATGACTTCCATTCCANAACCCAGAGAGGTAGGAGAGAACCAGCTTCCATAANTTATCCCAGCCTCCCCTGTNC
AAACNCACANNNTGAAAGAATGCNNAAGANACTTCTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI20164

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 74439789..74440148 340
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069814 (E130309D14Rik) NM_001013784 RIKEN cDNA E130309D14 gene Gene [Source:MGI Symbol;Acc:MGI:3588240]


Sequence tag IST14957F5HMR1
Sequence
AGACAAGTCTCTCTTTACATAGCCCTGGATATCCTGGAACTTGATATGTAGACCAGGTTGGACCTGAACTCACAGAGATC
TACCTGCCACCCAAGTACTGAGATTAAAGGCCTGAAATACAGGTTTTGTTTTGTTTTTTTAAAATTAAGTGTTTTTATAT
TTTATAATTTCATGCTTGAGTACTGTATTACATCATTTCCACCCCAACTCAAACAAACAAAAATTTACTGANCGCATTTA
GTATTGCTCTTATGTATATGCGTTTCGAGCTGATCACTTGGGACTGGATAATTTATCATGGGGTTCATCCCAANAGAANA
TTGATTCTCCCTCTCTTGGCAGCCATTGATTGACTGTTGCTCTTCANCNNNGGGTANGANCTTGACGTTCANAANNNCCC
TATCNCTCTGGCTGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 74439378..74439792 387
 
EST/CDNA Est Name
  CJ123838.1 - BE946371.1 - AW494940.1


Sequence tag IST14957F5HMF1
Sequence
GTCTCAAAAAAACAAAACAAAACAAAACAAAACAATGGACCAGTGGTAGAGGCACACGCTTTTAATCCCAGCACTTGGAA
GGCAGAGGCAGGCGGATTTCTGAGTTTGGGGCCATCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTATACAGAG
AAACCATGACTCAAAAAAGAGGATGAAAAGGGATAGAGTGGCAAGATGGCCCAACAAGTTAGGGCAATGGA
Sequence Type genomic DNA
Unitrap ID UNI20164

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 74439789..74440018 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069814 (E130309D14Rik) NM_001013784 RIKEN cDNA E130309D14 gene Gene [Source:MGI Symbol;Acc:MGI:3588240]

 
Come back to gene ENSMUSG00000069814


For any suggestions or comments, please send an email to unitrap@crg.es