Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13138A2
Clone ID IST13138A2
Vector VICTR74
Project tigm

Sequence tag IST13138A2BBF1
Sequence
GTTGGATGCGACACTTCTGAGTTACCCTAAATTTCCCAAGTCTGGAGAACGTCCGGGAAAGGACTTGGAAACAGCTGCGA
AGGATTCGGTCACAGGTATCTCAACCACCTCGGAGGGTGCAAGATGCACGCGCGGGGCAGTTCCTCCTGTTCAGAACACT
CANCCCACAGCTGACTCCCACTTCCGTACGATAACGCAAGATGGTGGGACCGGCGATTGAAAACCACATTCAAGATGTCG
GCTTCCGGTTTTCCCGGCAGCGTCCCGCGTGGCTGCCGGGGCCACGCCCACTTCCGGTTCCCTTGCTCCGGCATGGCTGC
CTTANGGACCTGGCTGTCCAGTGAGTGATTGTGGGGTTGGGGACACGGGAGCCGCGGGGCGACCAGCCCTCTAACTCCCT
GCTCTTCCATTANGTGTCCGGANATTGCACTGCAGCGTAGTGNCNCGGNCCNGTGGCCAGTGNCGACTCNNGTGAGTGCN
NTGCCGGC
Sequence Type genomic DNA
Unitrap ID UNI19446

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55045458..55045944 461
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010406 (Mrpl52) NM_026851 mitochondrial ribosomal protein L52 Gene [Source:MGI Symbol;Acc:MGI:1916086]

 
Come back to gene ENSMUSG00000010406


For any suggestions or comments, please send an email to unitrap@crg.es