Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14280G12
Clone ID IST14280G12
Vector VICTR74
Project tigm

Sequence tag IST14280G12BBF1
Sequence
GGAGATGGCCAACTGTCTACTGGTGATGGAACACAATGTACCGTAAAATGGCTGAAGAAGACACAACCAACCTTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 53965261..53965339 79
NO GENE  


Sequence tag IST14280G12HMR1
Sequence
TTCCAAGCATGTCTTATACTTTCTGAGCACTTGTAGTCACCTCCGAATGCTTGCCTCATTTCCCCAGGACAGTCCTAACC
TTCCCATAGATTTAGATTTCTTCTTTTAAGAGAAATGTGTGTCTTCTCCCAGGAGTAGGTCATTGGTCCCTAATTTTTTC
TCCCATAGTTCTTTCACCAGTTCAGCACAGTCAGCCTCTTTCTGTTGTGATTGCCTGGTTACATGCCTTTCCTACATTAA
TCCTANNCCGTTTGGAACCNAAAGGGTTATATTGTTGTTTTNNTTTGTCTGCTGCAGTGCCCACANNCCGTATTTACTTG
AAGAGTGTTNAATGTGTANATCTATCTAAGACTGTGGAAAGCTTTTGGAACCCCTTGGCAGGAATTTGATACTGGGCCAT
GACAAGGAANTTGGTTCTGGCANGAATCTAATTTTNNNCTNNAACN
Sequence Type genomic DNA
Unitrap ID UNI25580

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 53964830..53965263 412
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006763 (Saal1) NP_084509 serum amyloid A-like 1 Gene [Source:MGI (curated);Acc:Saal1-001]

 
Come back to gene ENSMUSG00000006763


For any suggestions or comments, please send an email to unitrap@crg.es