Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10335H6
Clone ID IST10335H6
Vector VICTR76
Project tigm

Sequence tag IST10335H6HMF2
Sequence
AGAGCCCATGGCCNTCAAGCTGGGAGCGTGGTGCCNGGCNGGCATGATCTACACAGGGGAGAGAGAGAGAGAGAGAGAGA
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 77687408..77687524 111
NO GENE  


Sequence tag IST10335H6BBF1
Sequence
AATTTATTTACAAAGTTGCCTCTTGTAAGTAAGGTATGAAGCTTTCTTTTATTCAAAGACAGACAGACAGACAGATACAC
ACATACACACACACTTCCTCCCCTGTACTTCCCTCTGAGGCCACTCAGAGAGTGACCACCTACACGCTGGTGTCTGTGTG
AATCATATGGTGCTGGCGGTGGCCTGCAGTCAGTCACCAGGCAATACCACCCAGGGAGCAGGATTTCTCTCAGGCTGGCA
ATAAATCCCAAGGAGAATCCCTGGTCTTTGAGACAGGGTTTTCTTAANGCAACAAAGAGAGGACAGCGTGAAGATAAAGG
CTTCTGANANGCCCTGGANAAATCAATGGAGATTTAANAACCNACAAGCATTGTGAGGGTGTGTGCCCCGTGTGCTTTAT
AAACGTGCCCCTCTGTGATTACACTCGCTGTGTCAGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI28133

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165622614..165623054 429
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es