Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12370A4
Clone ID IST12370A4
Vector VICTR76
Project tigm

Sequence tag IST12370A4HMF2
Sequence
GTGACCTTCTCCCAGAACCCGGCCAGGTGCGCAGGTCAGGGAAGTAGAAGGACTCAGGTCTAGGGCCTTGAGTGGAGAAG
NGNNGGAGGGTCTGGTGGAGGGTGGACCTCCGCCCCTCCCCTAAAAGGCTGTTTCCCTCCTCATCCAGCACTCACCTGGG
CAGGTCTGGGTCTGGCCTTGTGAGGCAGCCAGGAGGATCAGGAGGGTGCCAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36326840..36327050 205
 
EST/CDNA Est Name
  AK033602.1 - NM_008208.2 - AY989871.1 - AY989877.1 - AY989876.1 - AY989878.1 - BC125380.1 - BC125378.1 - AY989875.1 - AY989874.1 - NM_001030310.1


Sequence tag IST12370A4BBF1
Sequence
AAACATATATATATATTAATTATACTTTGGCTCTGATGTGGCTGAAGACATAGAAATTAAACGAACCTAAGACCCTTTTG
GAAGTGCTATTCAGGCATGTGCGAGTGCTCACACATTCTGGCTCAGTTTTCAATTGTAAGTTACAAGAAGCAGGCTAGGG
TTGTTATGGTTTGAAACCAAGAATGTATCCTGAAAGCTGATGTGTTAAGGAAATGGTTGCCAACTGAGCAGATTTTGGAG
AGGTGACTGGGTTATTAAGGGTATAATTCCATCCATCAGTGAACCATTGATCAATTCATGAATGAACTACTGCCAGGTGG
CCCGCTTGGTGAATGTTGGTTACCGGAATATGCTATTTCTGTGATCCCTAGCTGCCAAGGCAGCTCTGATCTGCCACATG
CCTTCTACCGTGATGTGCTGCCTCACACAGGTCTGANAGCNACGGANCCNGCTGCCCGTGGCCNGANACCTCTGAAACCA
GGAGTCAAAATAGACATTTCCTCCCTTANCTAGGTTTTCTTANNTAGTGN
Sequence Type genomic DNA
Unitrap ID UNI30685

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 57394759..57395287 511
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075007 (AC144776.2) FIL1L_MOUSE Isoform 2 of Q6P6L0 - Mus musculus (Mouse) [Source:UniprotKB/SpliceVariant;Acc:Q6P6L0-2]

 
Come back to gene ENSMUSG00000075007


For any suggestions or comments, please send an email to unitrap@crg.es