Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14599A6
Clone ID IST14599A6
Vector VICTR74
Project tigm

Sequence tag IST14599A6BBF1
Sequence
GGAGCCTTTCTNAGCTGTATTTATGGGTGGCTGGAGGTACCTGCTGTCCTGAGGGGCCGGAGAAGGTGGACTCTATCTCC
CTTTTGTTTCTGACATGGGGCCTGAGTGTCTTACACGAGACGTAGTGGGAGGCTGGCCTGGTGGCCTANACATCCTGGGT
CTGTGGTGGTAATTCCTCCTTCNNCCNTTTCCNTANNGNNNNATACACNNTGCNNANTCCTCNATGCTCCCTACCGAACA
CATTTCTGCCNCTCTANCTNGCCCANTGNNNNCATTGGCCCTAANTGACNCTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14599A6HMF1
Sequence
GGAGCCTTTCTNAGCTGTATTTATGGGTGGCTGGAGGC
Sequence Type genomic DNA
Unitrap ID UNI15349

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29482644..29482680 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039844 (Rapgef1) NM_054050 Rap guanine nucleotide exchange factor (GEF) 1 Gene [Source:MGI (curated);Acc:Rapgef1-001]

 
Come back to gene ENSMUSG00000039844


For any suggestions or comments, please send an email to unitrap@crg.es