Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14884E6
Clone ID IST14884E6
Vector VICTR76
Project tigm

Sequence tag IST14884E6BBF1
Sequence
GTACACTCTGTAGCTGAGTACCTGGACACCTGACTGGCAAATCCAGTTCCCAGACTGCAGTCTCTTAAGACGAGCATCTG
TCCTTCAGGAACTGAACAGGGCCCTAGGGAAAAGGCTGACTCCAGGGCTCAAAGCAGGAGGTACACACAACTGGAACATC
TATAGTCTGAGTCAAACACATAAAAAACCAAGAACCCTTAAAGAAGGGGATGTGTCAAACAAGACAGAAACTAAAGGAGA
GTGCTAGGGTCTAAAGAACTTCAGCAAAAACATAAAAGCAGTATTTGAGTATACAACCTGAACAAATAACTTTGAGTCAT
GCTGATAAGAACAAATTATTANACACTTAACACATGGTTGGATANAGACANGTTTTCCTCNNNANGAACTCCANNANNCA
NANATNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148336257..148336649 379
NO GENE  


Sequence tag IST14884E6HMF1
Sequence
GTACACTCTGTAGCTGAGTACCTGGACACCTGACTGGCAAATCCAGTTCCCAGACTGCAGTCTCTTAAGACGAGCATCTG
TCCTTCAGGAACTGAACAGGGCCCTAGGGAAAAGGCTGACTCCAGGGCTCAAAGCAGGAGGTACACACAACTGGAACATC
TATAGTCTGAGTCAAACACATAAAAAACCAAGAACCCTTAAAGAAGGGGATGTGTCAAACAAGACAGAAACTAAAGGAGA
GTGCTAGGGTCTAAAGAACTTCAGCAAAAACATAAAAGCAGTATTTGAGTATACAACCTGAACAAATAACTTTGANTCNT
GCTGATAAGAACAAATTATTANACACTTANCACATGGTTGGATAGAGACAGGTTTTCCTCAANANGAACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148336261..148336649 377
NO GENE  


Sequence tag IST14884E6HMR1
Sequence
GTACAACCCGTTACCGTGATCATATCGGTTCTAGCATCTGTCTTGAAAGTCCCCCTGCAGTGTANCGACTTCCCTTCTGC
CCTCCATCGAGTGCCACGGCATCATGGGGCTCTGCATGGCGATCANAAGCACCATGTGTTTTGCAGATAGTTTAAAACTA
AGAACAGGTGGGTACCTTTGAGCCTAAACTTGTGTCAAACCTANACCTCATCTTCTCTGACGTCTGAGGCCTTTGGGGCC
TAAGCCGGANNGTGGCTTCNNGANNNTN
Sequence Type genomic DNA
Unitrap ID UNI14633

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148336646..148336904 249
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025495 (Ptdss2) NM_013782 phosphatidylserine synthase 2 Gene [Source:MGI Symbol;Acc:MGI:1351664]

 
Come back to gene ENSMUSG00000025495


For any suggestions or comments, please send an email to unitrap@crg.es