Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11062H10
Clone ID IST11062H10
Vector VICTR76
Project tigm

Sequence tag IST11062H10HMF1
Sequence
CAGAGACATCCGGGNCAAATGTGCACTCTGGTAATGACAAAGCCGCCATACTTGAAAGCTTACATCAGACTGTGAGCGTT
AGAGAAACCCTTGCTGTCTCAGCTGAATTCCATCCACCAAATTTGCAGTAGTTCACTAAAGGCTCGCAGAGCTAAACACT
AATGCTTTAAGTCTGAAATTCCTGAAAAAAAAATGTTAGCTTGGTTTGATCTTATCGTTCGGGCTAATCGACTCTTGTAT
GCTAAGTGGTTATATGTTGGCTTTCAAAGGGAAAATTTCAGTCANAAGTATTTGAACTTCAGGTGAACTTTGGGTATTTT
TGCAAGATAAGAAAGTAGTTTGGTGGA

Sequence Type genomic DNA
Unitrap ID UNI10394

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 107843670..107844015 342
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035873 (Pawr) NM_054056 PRKC, apoptosis, WT1, regulator Gene [Source:MGI Symbol;Acc:MGI:2149961]


Sequence tag IST11062H10BBF1
Sequence
CAGAGACATCCGGGACAAATGTGCACTCTGGTAATGACAAAGCCGCCATACTTGAAAGCTTACATCAGACTGTGAGCGTT
AGAGAAACCCTTGCTGTCTCAGCTGAATTCCATCCACCAAATTTGCAGTAGTTCACTAAAGGCTCGCAGAGCTAAACACT
AATGCTTTAAGTCTGAAATTCCTGAAAAAAAAATGTTAGCTTGGTTTGATCTTATCGTTCGGGCTAATCGACTCTTGTAT
GCTAANTGGTTATATGTTGGCTTTCAAAGGGAAAATTTCAGTCAGAAGTATTTGAACTTCAGGTGAACTTTGGGTATTTT
TGCAAGATAAGAAAGTAGTTTGGTGGCCAGCTCTATACATATGTGCCTTGCATTTACTTGACTGTTAGCTAGCACTCCCC
ACTGAACCCCCACACACCACCCCCCATTTCTCTGTTTTAATCACCTTAACCTTTTGTGCNAGCNAAGAATGCCNGANGTT
TTTCAATGGCAGANNAGANCAAAAGANNACANAAAGGTAGCANTTACNGTGNANGNNNACTTTCCTACAGCTTN
Sequence Type genomic DNA
Unitrap ID UNI10394

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 107843670..107844222 512
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035873 (Pawr) NM_054056 PRKC, apoptosis, WT1, regulator Gene [Source:MGI Symbol;Acc:MGI:2149961]

 
Come back to gene ENSMUSG00000035873


For any suggestions or comments, please send an email to unitrap@crg.es