Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12426E9
Clone ID IST12426E9
Vector VICTR76
Project tigm

Sequence tag IST12426E9HMF1
Sequence
AAGGTATTGTATGGGCCTCAACCTTGACTTACCCAGGTGGTACCTGGGTTGTGTGTGTGTGTGTGTATGTGTATGTTTGT
GTNTGTGTGTNGN
Sequence Type genomic DNA
Unitrap ID UNI13978

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148154335..148154424 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025491 (Ifitm1) NM_026820 interferon induced transmembrane protein 1 Gene [Source:MGI (curated);Acc:Ifitm1-001]


Sequence tag IST12426E9BBF1
Sequence
AAGGTATTGTATGGGCCTCAACCTTGACTTACCCAGGTGGTACCTGGGTTGTGTGTGTGTGTGTGTATGTN
Sequence Type genomic DNA
Unitrap ID UNI13978

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148154335..148154404 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025491 (Ifitm1) NM_026820 interferon induced transmembrane protein 1 Gene [Source:MGI (curated);Acc:Ifitm1-001]

 
Come back to gene ENSMUSG00000025491


For any suggestions or comments, please send an email to unitrap@crg.es