Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11565F10
Clone ID IST11565F10
Vector VICTR76
Project tigm

Sequence tag IST11565F10HMR1
Sequence
NCCTTANGGCNGCNNTTNNNAACCTGTTNNNANNNNNNCNNNANGCTCTGTCCATCNNCNGATGGATTTAAAATGTTCTC
ANATCTACCTTGGACATGATGTCTGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11565F10BBF1
Sequence
TTTTTAAGATTTATTTGTACAGATGTTTATGTACATACNCATTTTTGTANTTTTAGATATGGCTACTTGCATGGGGAGGG
GGGAACCAATAACACCCAGATGTTAATAGTGTTTATGGATTTGAATTACTANATCTG
Sequence Type genomic DNA
Unitrap ID UNI36518

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 131006601..131006735 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027329 (Spef1) NM_027641 sperm flagellar 1 Gene [Source:MGI (curated);Acc:Spef1-001]

 
Come back to gene ENSMUSG00000027329


For any suggestions or comments, please send an email to unitrap@crg.es