Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST435293
Clone ID OST435293
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST435293
Sequence
AGACTCTGCAGGCTGACGGTTTGAGCTCTCGTGCCCGCAGTCTGNTTCCACAGCCGGAGAGTCAAACACAAATTCTGTGG
AGAATCTTCAAGAGAAAGACCTTCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNGTCACCATCCATCACTCCAGNTCTAGGAGAGCCTAGGACCTCTTTCACCTCCATCAG
GACCATACTG
Sequence Type mRNA
Unitrap ID UNI17833

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 117819237..117820466 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079412 (Zfp239) zinc finger protein 239 Gene [Source:MGI (curated);Acc:Zfp239-005]

 
Come back to gene ENSMUSG00000079412


For any suggestions or comments, please send an email to unitrap@crg.es