Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13777A7
Clone ID IST13777A7
Vector VICTR74
Project tigm

Sequence tag IST13777A7BBF1
Sequence
TTTGGACCTCCTCCTGGCCGAANAANAAGGCCCAAAACAGGACCTTTCTCAGACAGTGTGTTGCTTTGGCAGTTCCCAGG
TGGTACAGACTCTCACCTAAGCAGACTAAATTCCTAAGTTCCTTGGAGTCCCGGGACCAAGATGGCGACCGCTGCTGCTG
TGGCTTAGGCCGCCTCCCCAGCCGGGTGGGCACCTGTCCTCCGGTCCGGAAGGTGGCCGGCTGTCCCCGGCCN
Sequence Type genomic DNA
Unitrap ID UNI31065

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 31757523..31757754 228
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 55223647..55223878 228
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 23740628..23740859 228
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 22363432..22363663 228
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 7129389..7129620 228
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 25142381..25142612 228
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 28188378..28188609 228
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022262 (Dnahc5) NM_133365 dynein, axonemal, heavy chain 5 Gene [Source:MGI Symbol;Acc:MGI:107718]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 26128037..26128268 228
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 64020726..64020957 228
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 27620651..27620882 228
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 13974719..13974950 228
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 40217233..40217464 228
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 26011538..26011769 228
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 14606235..14606466 228
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 16261392..16261623 228
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 18535593..18535824 228
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 62715367..62715598 228
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 28624278..28624509 228
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 82251743..82251974 228
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166438: 133869..134100 228
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 18769810..18770041 228
NO GENE  


Sequence tag IST13777A7HMF2
Sequence
TTTGGACCNCCNCCTGGCCNAAAAAAAAGGCCCAAAACAGGACCTTTCTCANACAGTGTGTTGCTTTGGCANTTCCCAGG
TGGTACANACTCTCACCTANNCANACTAAATTCCTAAGTTCCTTGGANTCCCGGGACCAANATGGCNACCGCTGCTGCTG
TGGCTTANGCCGCCTCCCCAGCCGGGTGGGCACCTGTCCTCCGGTCCGGAAGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000022262


For any suggestions or comments, please send an email to unitrap@crg.es