Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14461E11
Clone ID IST14461E11
Vector VICTR74
Project tigm

Sequence tag IST14461E11HMF1
Sequence
AGTTGAGATATAATCAGTACGTCTCTTCACGTATTGATCTAGCTCGCCAGACTAGAAATCACCGAGATACCGATTTCTCA
CGACACTCGCGTCTCGCACCACGTGCTCCGGGCGCGGACCAGTCATTGGTCGGTGTCCCCTGGGGGCGTGCCCCGTGCAT
CTGTGGCACAAGATGGCGCTGCCCTTTGCACGCTGTTGGAAGTTGTACCGCTGGGGCACCAAGCGATGGGGGGTCCCTGC
TGTGGAATCCCGGANANGTANGCATATTTCNTTTNNACNGNNANTCN
Sequence Type genomic DNA
Unitrap ID UNI19515

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127648748..127649021 266
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051346 (Spryd4) NM_025716 SPRY domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1913951]


Sequence tag IST14461E11BBF1
Sequence
AGTTGAGATATAATCNGTACGTCTCTTCNCGTATTGATCTAGCTCGCCAGACTAGAAATCACCGAGATACCGATTTCTCA
CGACACTCGCGTCTCGCACCACGTGCTCCGGGCGCGGACCAGTCATTGGTCGGTGTCCCCTGGGGGCGTGCCCCGTGCAT
CTGTGGCACAAGATGGCGCTGCCCTTTGCACGCTGTTGGAAGTTGTACCGCTGGGGCACCAANCGATGGGGGGTCCCTGC
TGTGGAATCCCGGANAGGTANGCATANTTCNTNTNNANNGN
Sequence Type genomic DNA
Unitrap ID UNI19515

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127648752..127649021 258
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051346 (Spryd4) NM_025716 SPRY domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1913951]

 
Come back to gene ENSMUSG00000051346


For any suggestions or comments, please send an email to unitrap@crg.es