Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14579G2
Clone ID IST14579G2
Vector VICTR74
Project tigm

Sequence tag IST14579G2BBF2
Sequence
TTAACAGACAAGACATGGGCTGGCGANGNGGCTCAGCGGGTAAGAGCACTGACTGCTCTTCTGTAGGTCCCAATCCCAGC
AACCACTTGGTGGCTCACAACCACCTGTAATGAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 114036423..114036540 109
NO GENE  


Sequence tag IST14579G2HMF3
Sequence
GGTANAATTGTGATTCNNNGTCNNGNNNNNNCNNAAATGACCTAACCAATACTTGTTGGAGAGGAGAAAGTTTCAAGACA
AGCAAGACCAACAGTGCAAACACTGAGACTCAGGCCTTACTGCAGTCTCTTGCACTCTTCATCATGCATGGCCTCCCCAG
ATTGCCCCCACCTTAACTAGGTTCCAGATGGTGCTTTCAGCGTAGCTCGGCATTTGCAAAGCCAAGCCCATTTCCCCAAC
CTTTCAGACACCATGAGCAGCTGGTGGTACACAGGCCCAAGACAACAGGTCTGCCCAGCAGCTGATGATGTGACCCAGTG
TGGTACTGGACTANGTGCCTCTTAACTAAAAAGAGAGGGATGCANCCCCCACCCCCTTCCCTACCTGACAACTGGCTACT
CCAAGGGGGTAAGCAGGACCCAGGGGAAAAACCAGGGAACAGGCAGGCATCACAATACAAAAGGCATTTGANAACCNNGN
AAATTNNNANNGGGCANAGGAAAANNGGATTGGGAAANNNGGATCANTGACNNGANGAAATTTNCTGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14579G2HMR1
Sequence
CCGTGNCTGCNNANCTNATTGGGAGGCCCTCCCTGTGTGTACNNNTCAGGTTGTAAGAAAGCAGGAACAAAAGTAGGTCT
CCCTGACATGCTAGCCACAGGCAGTCTGCAGGATTCTGGAGCCCCTGGGATGCTGCATTTTGCCAAGAAGAAGGCAAAAG
CTATAAGAGGGAGGGTCACGTGATGGGTCAGAGCAGTGCTCAGAAATCCCANGAAAGAATGGGAGACAAAGAAAAGGAAA
AAACTGACCCCGGAAAAGTAAAAAAACAAGGCAGAGGCGGGGTTGANAAAGAGGTGAGCANAAACTAGAGGCCCAAGGCA
CTTGGAACCAGAGAGGCACAAATTCCANTGGTGCGGGCAGGACAGTGTCCTCAGGTGACACTGCATTTCAGGCCTGCTAT
TGTACTCTAGAGACCNNCTTCTCTCTGGGATGTCTTAAGTGGTCTANACTGGCCCATTTGATGTAAGTNATCTTTCACCT
TTTGAAATTATTAAATANGACGGACAGCTTACTATTATTTTCTGTCATGGTGACTCCCTTAAAAATCCTCTCTCTGGNAC
TCNGAGGCNCTTCN
Sequence Type genomic DNA
Unitrap ID UNI15182

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 43569695..43570267 533
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028465 (Tln1) NM_011602 talin 1 Gene [Source:MGI (curated);Acc:Tln1-001]

 
Come back to gene ENSMUSG00000028465


For any suggestions or comments, please send an email to unitrap@crg.es