Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11073C11
Clone ID IST11073C11
Vector VICTR76
Project tigm

Sequence tag IST11073C11BBF1
Sequence
TGAGGACCTGAGTTCAATCCACAGCACCCACATAAAAC
Sequence Type genomic DNA
Unitrap ID UNI12914

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3352878..3352915 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069806 (Cacng7) NM_133189 calcium channel, voltage-dependent, gamma subunit 7 Gene [Source:MGI Symbol;Acc:MGI:1932374]


Sequence tag IST11073C11HMF1
Sequence
TGAGGACCTGAGTTCAATCCACAGCACCCACATAAAAC
Sequence Type genomic DNA
Unitrap ID UNI12914

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3352878..3352915 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069806 (Cacng7) NM_133189 calcium channel, voltage-dependent, gamma subunit 7 Gene [Source:MGI Symbol;Acc:MGI:1932374]

 
Come back to gene ENSMUSG00000069806


For any suggestions or comments, please send an email to unitrap@crg.es