Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14571E2
Clone ID IST14571E2
Vector VICTR74
Project tigm

Sequence tag IST14571E2BBF2
Sequence
NNNNNNNNNGTTCCNNNTTTGCAGATNAGAAAACTGAGCCCATTCCCAGACCCTACACAGGCAAGCTGACTCTCANTTAT
ATCCNGACAACTGTCCCCTGTATGCANACACCTCANAGAAGGGGCTTCCANAATGTTCCACACTGCTGGCCTGCTTTTAC
CCTCCTAAAAGCCAAACTCCCTGGTGTGCAGGTTTTTCCCTTGGAGACATCAACAGACACTTAATTCACTTTTGTCCAGA
GGCAGCCAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 118894427..118894670 226
NO GENE  


Sequence tag IST14571E2HMR1
Sequence
TTTACNNGTACCCCCAGAGCTCGAGTCTCTAGCTGCATATGTAGCANAAGATGGCCTAGTT
Sequence Type genomic DNA
Unitrap ID UNI10738

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 93965157..93965210 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 21134261..21134314 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 97003567..97003620 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032449 (Slc25a36) NM_138756 solute carrier family 25, member 36 Gene [Source:MGI (curated);Acc:Slc25a36-001]

 
Come back to gene ENSMUSG00000032449


For any suggestions or comments, please send an email to unitrap@crg.es